Query (optional)   in Class  

GrainGenes Sequence Report: i_12_21476

[ Printable Version ]  [ Submit comment/correction ]

Sequence
i_12_21476
Species
Hordeum vulgare
Probe
i_12_21476
Remark
E-value: 1e-57, Bitscore: 220.0
DNA Homology
AK250031.1BLASTN
DNA
aaataaagcaatcgccgatggctatgctgacttggtagcatatgggcgct
tgtttttatcMaatcctgacttgcctcggaggtttgaaataggtgctcct
ctcaacaagtacataagagat
BLAST
BLAST Search