Query (optional)   in Class  

GrainGenes Sequence Report: i_12_30230

[ Printable Version ]  [ Submit comment/correction ]

Sequence
i_12_30230
Species
Hordeum vulgare
Probe
i_12_30230
DNA
ggcgcgtgcgagtagctagagtgggcgggatgcatgctgcacacgatctc
acgttttaccRgttctcctgatcagcagaagctgcgctaagaggccttgg
gatggcgcggcagaatcggat
BLAST
BLAST Search