Query (optional)   in Class  

GrainGenes Sequence Report: i_12_30420

[ Printable Version ]  [ Submit comment/correction ]

Sequence
i_12_30420
Species
Hordeum vulgare
Probe
i_12_30420
DNA
aaaaaaaaaaataaactctggttcgtctgcttaaactgttgcttgcgggc
tgtatccactRcctgaatgtttgtttacttcccaaaaaaaaaaaaaaaaa
cccctctttccaaattacttg
BLAST
BLAST Search