Query (optional)   in Class  

GrainGenes Sequence Report: i_12_31174

[ Printable Version ]  [ Submit comment/correction ]

Sequence
i_12_31174
Species
Hordeum vulgare
Probe
i_12_31174
Remark
E-value: 1e-57, Bitscore: 220.0
DNA Homology
MLOC_9938.2BLASTN
DNA
tgcatcatctccttatgtcacagatacatttcccagccattttctgcatc
cgcaagctctRtatctctttctctcacacacacagttccttaaccccact
tacattttcagatgcatgttt
BLAST
BLAST Search