Query (optional)   in Class  

GrainGenes Sequence Report: tplb0025f09_1052

[Submit comment/correction]

Sequence
tplb0025f09_1052
Contig
4DS_2275675
Probe
tplb0025f09_1052
DNA Homology
4DS_2275675Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-444DS_2275675Best IWGSC match
DNA
tgctgggaagcatgcatgaaaacagaagacctgacaggagcaccagcttg
Rccaggactgtagggtggcataacaccatctggaggcctgtagccaactg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.