Query (optional)   in Class  

GrainGenes Sequence Report: tplb0034e07_718

[Submit comment/correction]

Sequence
tplb0034e07_718
Contig
2BS_5192454
Probe
tplb0034e07_718
DNA Homology
2BS_5192454Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442BS_5192454Best IWGSC match
DNA
acgtatcatgtgaactgaatggtgatgaaaaaactgaatcttcttgcaat
Rctgctgtgaatgtggaacatgattccagtttgtgcaaagaaattgataa
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.