Query (optional)   in Class  

GrainGenes Sequence Report: tplb0055h14_483

[Submit comment/correction]

Sequence
tplb0055h14_483
Contig
6DS_2071688
Probe
tplb0055h14_483
DNA Homology
6DS_2071688Best IWGSC match1595e-37URGI_BestIWGSC_N
BLAST, e-value
5e-376DS_2071688Best IWGSC match
DNA
tatggggcctgctactctttggtggccgcggtcttcttcttgggggactt
Rgtggaggtcttcttcttgggcgacttggcctccttctcggcggcggcgg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.