Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_BE444579B_Ta_2_1

[Submit comment/correction]

Sequence
wsnp_BE444579B_Ta_2_1
Contig
3B_10371562
Probe
wsnp_BE444579B_Ta_2_1
DNA Homology
3B_10371562Best IWGSC match2200URGI_BestIWGSC_N
BLAST, e-value
03B_10371562Best IWGSC match
DNA
ggacttacctgctaccataagtcaaaagctgcctccctatatcttctgca
acaattacctRcagtgcaaagttaacagatggatatcaaatccttttaaa
tatacgtgataactgacaaga
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.