Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_BE495786A_Ta_2_1

[Submit comment/correction]

Sequence
wsnp_BE495786A_Ta_2_1
Contig
1AL_3884150
Probe
wsnp_BE495786A_Ta_2_1
DNA Homology
1AL_3884150Best IWGSC match2200URGI_BestIWGSC_N
BLAST, e-value
01AL_3884150Best IWGSC match
DNA
CCTAAATATTTTAGTTGCCTCTTCAATGGAGTATAAAAGGAACATTAAGA
GAATGATACAKAACAAGAAAGAACTAACCTTATTTTTAGAATTTTTGTCC
ATCTTTGTTACTGTTGCTTTC

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.