Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_BF293133A_Ta_2_2

[Submit comment/correction]

Sequence
wsnp_BF293133A_Ta_2_2
Contig
3AS_3443437
Probe
wsnp_BF293133A_Ta_2_2
DNA Homology
3AS_3443437Best IWGSC match2000URGI_BestIWGSC_N
BLAST, e-value
03AS_3443437Best IWGSC match
DNA
GCGAGAAGGTGAGCGGCGGCCTGTCCTTCCTGAAGAAGAAGAAGAAGAAA
CAGAGACACTRCCAGGATTCAGAAAACCGTCCACCACCATTGCTGGAAGA
AGAAGCGGRGAAGAAGATGGG

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.