Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_BF473884A_Ta_1_1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_BF473884A_Ta_1_1
Contig
7AS_4246451
Probe
wsnp_BF473884A_Ta_1_1
DNA Homology
7AS_4246451Best IWGSC match2200URGI_BestIWGSC_N
BLAST, e-value
07AS_4246451Best IWGSC match
DNA
ACACTCCCTATCCATGTCAGGTATAACTTTCACGCTTTGGCATATGCTTT
CAGCATGAGGRAATCTGGCCATAACTAACACATCTCAAAATATTCCAGCC
TGTAGGAGGAACGTTCCCAGT
BLAST
BLAST Search