Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_BM137927A_Ta_2_1

[Submit comment/correction]

Sequence
wsnp_BM137927A_Ta_2_1
Contig
3B_10526271
Probe
wsnp_BM137927A_Ta_2_1
DNA Homology
3B_10526271Best IWGSC match2090URGI_BestIWGSC_N
BLAST, e-value
03B_10526271Best IWGSC match
DNA
CTCTGGCTATTTCAAAGTGGCTCCTGAAGTCGATGTCGATGATCAGACGC
TCTGGACCCGKCAGGTCGTTGTCTATTATGACATCAATGTACTCATGGTC
ACCTGGTTGGCAAAACAATAA

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.