Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_CAP11_c1902_1022408

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_CAP11_c1902_1022408
Contig
5BL_10737438
Probe
wsnp_CAP11_c1902_1022408
DNA Homology
5BL_10737438Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
05BL_10737438Best IWGSC match
DNA
GGAAGGAAGGAGGTGCATCAGAGTCGATGTGGGCATGAGGTGTCCTAAGT
TATTTGTAGCCGGTCTTTGTGTTGTCAGTTACCGCGATCTCTGCAGGCGA
YAGATGTCTGCGCAGGTCGCGGTGGTGTCTGTACCGTACCGCTGCTTCTT
TGTTTACAAGCATTGGTTTGTTGTACCAGTTTTACATAATAATGAATGTT
G
BLAST
BLAST Search