Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_CAP11_c210_199161

[Submit comment/correction]

Sequence
wsnp_CAP11_c210_199161
Species
Triticum aestivum
Probe
wsnp_CAP11_c210_199161
DNA
atacaagcgagagtggtaccttacggccggggcgagctacaatgccaacg
gggccaRCGGGAGGAAGTACCTGCTTCCCGCGCTGTTCGACCCTGACACG
TCCACCTGTTCGACCTTGGTGTAATTTACTATGGTGCAATTTGTAAGGAT
ACGTAGT
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.