Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_CAP11_rep_c4382_2067038

[Submit comment/correction]

Sequence
wsnp_CAP11_rep_c4382_2067038
Contig
5BS_2274687
Species
Triticum aestivum
Probe
wsnp_CAP11_rep_c4382_2067038
DNA Homology
5BS_2274687Best IWGSC match2870URGI_BestIWGSC_N
BLAST, e-value
05BS_2274687Best IWGSC match
DNA
AGTGCAAGTTGAAGTAACGCATATACATGCCATGTTAGTTCACATTTGTC
GGCAGCTCTGCTTTCTCGGTTTTACTTCTCGTACTACTCGTATGTGAATA
YATGAGCATATGTATGTAAGCACCTACCAACGTAGGTCGAGGAGGATGCA
TATGAGAATTATAGCACCGGCTATACATACACACATATATTATATGCAAT
C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.