Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_CAP12_c1960_972031

[Submit comment/correction]

Sequence
wsnp_CAP12_c1960_972031
Contig
1AL_3960559
Probe
wsnp_CAP12_c1960_972031
DNA Homology
1AL_3960559Best IWGSC match2700URGI_BestIWGSC_N
BLAST, e-value
01AL_3960559Best IWGSC match
DNA
aagaaaccggttcaacaagcgggcggcaatatagatgccttaagtcttca
atatagagtagaaccggctggcggttcgggcatttatcggaggcggcttc
Rgcttagaagccgtggatcttgatgagctccttcttcgcaatyccagcct
ggactaggaaagtagcaacattcttacgctgatcaccctgaagctgaatg
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.