Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_CAP12_c4924_2241879

[Submit comment/correction]

Sequence
wsnp_CAP12_c4924_2241879
Contig
6DS_2071140
Species
Triticum aestivum
Probe
wsnp_CAP12_c4924_2241879
DNA
attctcaaatcgatacataggacaaatatgtatactcctttttatttaca
tgtactggagggaaaggtgctcctgatacttgtcggtggtggtggtgctc
Rcgaggctcgccgcttcagcaagttcaactttcaagctttatgcggagcg
gctggtaacctcaacctatgatgttattacaggcaaccaagaagaaaact
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.