Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_CAP12_c80_46551

[Submit comment/correction]

Sequence
wsnp_CAP12_c80_46551
Contig
2BL_7950718
Species
Triticum aestivum
Probe
wsnp_CAP12_c80_46551
DNA Homology
2BL_7950718Best IWGSC match1545e-35URGI_BestIWGSC_N
BLAST, e-value
5e-352BL_7950718Best IWGSC match
DNA
TCGGCGCACGTCGCCGGCGGCCGTATATCGATCCAAGGCTTACGTACGTA
ACTGCATGGATGCATGATATGCTACGTAGTGTAATTAATTTTGGACGGGA
YGTGTGTGTGTGTGTGTGTGTGTTGTTCCTAACTTCCAAAGTGCTGTGAT
ATGGCATGGATCGATCAGACATGATAAATAGAATTAAATAGGTACTATTA
T

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.