Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_CD452643B_Ta_2_1

[Submit comment/correction]

Sequence
wsnp_CD452643B_Ta_2_1
Contig
6BL_4211861
Probe
wsnp_CD452643B_Ta_2_1
DNA Homology
6BL_4211861Best IWGSC match2200URGI_BestIWGSC_N
BLAST, e-value
06BL_4211861Best IWGSC match
DNA
GTAATTTGGAAAATTGTTGCAGAACCAAATGTTTTGTAATGCTTTTCCCA
ACTTTCAGTTRACAATGCTAAATTAAGCAATTGAACTTCATTATTCGTCT
TGGTGTAATTAGTCTGTCCCT
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.