Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c11950_19164191

[Submit comment/correction]

Sequence
wsnp_Ex_c11950_19164191
Contig
2AS_5265661
Probe
wsnp_Ex_c11950_19164191
DNA Homology
2AS_5265661Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
02AS_5265661Best IWGSC match
DNA
CGGACACACATGGCAGTCACCATAAGATTGTTGTACCGATTTGTAAAACT
ATCTTACCCCGACGACGGAAACTAGATATATATGGTATGTGTTTACCGGC
RAACTATATATGGTCCATACAAAGTACAAACATTCTATAGCATATTTCAG
GTTAACTTGTGTAGTAGCGCCCACTCGCCGGATCAAACGTTTCTCGTTCG
A

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.