Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c13230_20872924

[Submit comment/correction]

Sequence
wsnp_Ex_c13230_20872924
Contig
6AS_4370549
Probe
wsnp_Ex_c13230_20872924
DNA Homology
6AS_4370549Best IWGSC match3440URGI_BestIWGSC_N
BLAST, e-value
06AS_4370549Best IWGSC match
DNA
ggttgtccctctctgctaatgctagctcgacgtagtcgaccgccgaatgc
actagctcatcgtccacccggstgatggtgtctttgatwcggcgtgccac
Raaggctaggtcgccagaggtgatgctctgtgcttcttcagcgacattta
tgtttattatcgcgttgccgaagtaaccgtccgggagcggtggcgtcatt
c
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.