Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c13686_21480826

[Submit comment/correction]

Sequence
wsnp_Ex_c13686_21480826
Contig
2BS_5164161
Probe
wsnp_Ex_c13686_21480826
DNA Homology
2BS_5164161Best IWGSC match3610URGI_BestIWGSC_N
BLAST, e-value
02BS_5164161Best IWGSC match
DNA
acagtcttgttgcttgaatttccatgcagctttgggtgacacccaacaag
atgaagtgcttctattgaggttggcagaccacaagtaggtaaagactgga
Rctctgtgcagtatgatatgctcagaaccttgagggctgtgagtctccaa
aagttttactgggaaagatgctgccgtcagtttggggcatttctcaatca
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.