Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c14101_22012676

[Submit comment/correction]

Sequence
wsnp_Ex_c14101_22012676
Contig
6BL_4401457
Probe
wsnp_Ex_c14101_22012676
DNA Homology
6BL_4401457Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
06BL_4401457Best IWGSC match
DNA
aggaatttcctttcccattggacctccgcagggaatttcagttccactca
gtgttcatctgtcctgtgcttcgtgagcaaggtagtgatgataatcctcc
Ratgcttcttccatgtgggcatgtcttgtcgaagcagtcgaccgcaaaat
tatcaaagagcagctcccggtctttcaaatgcccatattgcccgtttgaa
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.