Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c14173_22107343

Sequence
wsnp_Ex_c14173_22107343
Contig
7AS_4218466
Probe
wsnp_Ex_c14173_22107343
DNA Homology
7AS_4218466Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
07AS_4218466Best IWGSC match
DNA
ccaaagatgacctgcagagtcttctaggcttgcagctgcagtcactggac
ctgtgattgctcacatatcttggcatgtcctcatggcgcagctatgatct
Rgcaggacggttcgctgtcatccgtaatcgcttctttgcgcttcacctgt
tgaatggtggtttcttttgaaatgttcccggtgggaaagactcggccgtt
g
BLAST
BLAST Search