Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c14692_22766127

[Submit comment/correction]

Sequence
wsnp_Ex_c14692_22766127
Contig
6AS_4401466
Probe
wsnp_Ex_c14692_22766127
DNA Homology
6AS_4401466Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
06AS_4401466Best IWGSC match
DNA
ccacattagtgcaaacattaggagaattcttttctttagaacttggataa
caggtacaaaaatgcatattctgacaacatattctgatctctcattcaag
Maaacgaaaaccaagcacagatgctgtcacggcatggagttggcagctac
ccaaacaacacatgaatcacaggacttgggcggcggtgttcagcttctcg
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.