Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c15301_23529079

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c15301_23529079
Probe
wsnp_Ex_c15301_23529079
DNA
YGAGCGGAGTTATAAGCTCTTTTTAATAGTTTGGATTGCTTACCACGTGT
GTCACATGTTAGTGGTGTTATAAGCTGTGGTTTCACTAAAAATAATAATT
RTAAGCTCTGTTATCTCTCCTACAATAAAAAATAAGTAGTGTTCTAAGTT
TARAMWAGG
BLAST
BLAST Search