Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c1609_3069103

[Submit comment/correction]

Sequence
wsnp_Ex_c1609_3069103
Contig
1DL_1166848
Probe
wsnp_Ex_c1609_3069103
DNA Homology
1DL_1166848Best IWGSC match3640URGI_BestIWGSC_N
BLAST, e-value
01DL_1166848Best IWGSC match
DNA
tctctcgtccctcgcttcgaatcgcgtctgatttgagttcattcactcgt
cgtcgccgttgccttgctgtgctcgcagggcattcgaatccggcccgtgt
Mctccgcctccgtgcgagctcgggaagcgatcgatcgggggattcatcca
cttgtggcctccgtttggtttgcgattctatctcwgaatctgttttgtgt
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.