Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c16491_24996576

[ Submit comment/correction ]

Sequence
wsnp_Ex_c16491_24996576
Contig
6AS_4354010
Probe
wsnp_Ex_c16491_24996576
DNA Homology
6AS_4354010Best IWGSC match2410URGI_BestIWGSC_N
BLAST, e-value
06AS_4354010Best IWGSC match
DNA
caagagattggaaaaatattctgtccaaagtgtggcaatggtggcacctt
gcgaaaggtttcagtaacagttggtgaaaatgggatcactatggcttcac
Rgcgcccgcgtgttactctccgaggcacaaaattttcccttccaatgccc
caaggtggaagagatgccgtcattaagaatcccattttacgtgaagacca
a
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.