Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c16551_25061550

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c16551_25061550
Contig
5AS_1464255
Probe
wsnp_Ex_c16551_25061550
DNA Homology
5AS_1464255Best IWGSC match3640URGI_BestIWGSC_N
BLAST, e-value
05AS_1464255Best IWGSC match
DNA
aatcatgcaaaagaggcgattgctcgaagcgttgccgctgatccatctgg
ttcaaagattcgtagtccgaagatgcaatgctaacaccgagaggagcacc
Rgcattgtagatgtcatcgtcactgacaccgggraagtttgcttgggcat
tcggaaccgagagaccgctgccagaatgctgtaggcccagcgttagcgat
a
BLAST
BLAST Search