Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c17452_26163496

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c17452_26163496
Contig
5BL_10920225
Probe
wsnp_Ex_c17452_26163496
DNA Homology
5BL_10920225Best IWGSC match3640URGI_BestIWGSC_N
BLAST, e-value
05BL_10920225Best IWGSC match
DNA
ttgaaggaaaactacataaaaactttgtggaggagatttcatgtggcgct
tatcatgttgctgttttgacttccaggacagaggtgtatacatggggtaa
Rggtgctaatggccggttaggacatggtgatrctgatgataggaattctc
ctacactagttgaagctctgaaagataagcaagtcaggagtgttgtttgt
g
BLAST
BLAST Search