Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c17693_26438399

[Submit comment/correction]

Sequence
wsnp_Ex_c17693_26438399
Contig
7AL_4362990
Probe
wsnp_Ex_c17693_26438399
DNA Homology
7AL_4362990Best IWGSC match2680URGI_BestIWGSC_N
BLAST, e-value
07AL_4362990Best IWGSC match
DNA
cttgggttggtgttgatggaaggactggtgatattgttgacatgaaagag
cggaagatctgggattcttacagcgtgaaggcacagacgttcaagacagc
Ratcgagtctgcttgcatgcttctaaggattgacgacattgtcagtggaa
tcaagaagaagcaggctcctggctctggtgctcccaagcaaccccagatt
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.