Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c18382_27210656

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c18382_27210656
Contig
6DS_539203
Probe
wsnp_Ex_c18382_27210656
DNA Homology
6DS_539203Best IWGSC match3260URGI_BestIWGSC_N
BLAST, e-value
06DS_539203Best IWGSC match
DNA
ccatgacacacgtgctgtgtccccaggcaaacctcggaggtcgccctggr
acgttcagtattctccaggtgggtttctcttcggtcggatccaggaggta
Ragctgtgaagcagagtgaagacctgctaccgagccaccaaatatcataa
ttctccctccgggcaggctcacggcaacatgatcgaggcgaggaggcgga
c
BLAST
BLAST Search