Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c18511_27359312

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c18511_27359312
Probe
wsnp_Ex_c18511_27359312
DNA
CATATTTTTTTGCACGATGTACATAGCTTTTAAGGCTAGCAGAACCTTGA
GAAAAAGCTTAAAGCAAGGATGCATGTAGATCTGTCAAGCATGCATGTAC
RTGTAGTGTTTAAGGCTACCAGAACCTTCATATGTCCATTTGTTGTATAT
AGTTATATCTGATGATATTGTATGAAGATTAGTTGCTCTCTATTGGCCAA
A
BLAST
BLAST Search