Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c18637_27508578

[Submit comment/correction]

Sequence
wsnp_Ex_c18637_27508578
Contig
3AL_4363826
Probe
wsnp_Ex_c18637_27508578
DNA Homology
3AL_4363826Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
03AL_4363826Best IWGSC match
DNA
tgctgatttgtcctccaaaatgtctctaggaacaacaacaggcacagaaa
cagcctgtgatgtagtgtaaatatcttttacagctaccgactctgtaggc
Rgagcttttttagtgatcgaagaattaatagccatccctgtacgagataa
taattggatgtcccgctgtccgaaactgcgttctgctgtttttaaatttg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.