Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c18754_27630557

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c18754_27630557
Contig
5AL_2785733
Probe
wsnp_Ex_c18754_27630557
DNA Homology
5AL_2785733Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
05AL_2785733Best IWGSC match
DNA
ctaccattacttgccagtcgcaagggcttcaagataaatgggtaaagcaa
cggtagctcacatctacaacacatgcaaatagagttgtgaccacggttga
Mcactcatggatgtaccgaacacacggtagaggtgtcttagcaggttaac
tgggtatcttcagcttctgggtcttctgcatcaccacgggcagcttgcgg
g
BLAST
BLAST Search