Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c1997_3756118

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c1997_3756118
Contig
1AL_3905998
Probe
wsnp_Ex_c1997_3756118
DNA Homology
1AL_3905998Best IWGSC match2700URGI_BestIWGSC_N
BLAST, e-value
01AL_3905998Best IWGSC match
DNA
tggtgcatagaagaaacaaggcaagatggttttcttgatgtcatcaacaa
aactgcaggacaaggtggtccatcttcatctaataccatgatatcatatc
Rttcttctgtccaaaacttgaatggcgatctaatttgccatgaaagcata
tctaattcagcacgaacacttattgtctttagaattccttcwgtatcgtt
g
BLAST
BLAST Search