Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c20169_29215401

[Submit comment/correction]

Sequence
wsnp_Ex_c20169_29215401
Contig
2BL_8074188
Species
Triticum aestivum
Probe
wsnp_Ex_c20169_29215401
DNA
GCGCAAACTGTGGCACCGAATGTCACAGGCGAAACAACTGCAAAAGAGTA
TAGGCGATTTGCGGATAAACAACATGTGAGGACCGACCACAATGTCCCTG
MCCAAGCTATCTGTTTGATCGTTTCTTTACTGTAGACCATTGTGTTGTGT
AGCTAAGTGTGTGCGGCGAGAATGTGTTGGATTTCCTATAAAATCTGTCT
T

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.