Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c20495_29571203

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c20495_29571203
Contig
1AL_1065975
Probe
wsnp_Ex_c20495_29571203
DNA Homology
1AL_1065975Best IWGSC match3130URGI_BestIWGSC_N
BLAST, e-value
01AL_1065975Best IWGSC match
DNA
cgctctgaagaacgagccagaggaagaactgtatatgccggacaccgtgg
acgtggtgggtggcaaccggggtcaaggatcatcaggatgctgttagaac
Mtgaggccacaactgtcagctattcctttgacattactgtatttccatgg
tgacttgtggacccgtatttcattcgtgacctttttcaatcacctcgtaa
g
BLAST
BLAST Search