Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c2171_4072774

[Submit comment/correction]

Sequence
wsnp_Ex_c2171_4072774
Contig
5AL_2805189
Probe
wsnp_Ex_c2171_4072774
DNA Homology
5AL_2805189Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
05AL_2805189Best IWGSC match
DNA
ggttccaggacatcggacacatgtactgaggcaggatcagtcaccatgtt
ctcccttgtgaccagagcagactcctcatacaattccttctgaatatttg
Ratgttcaccttccaaacctgttttctcgaggttaaatactgattccagg
acatcagagacatcagcacaagaggcaggatcaaccaccattttatcact
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.