Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c22683_31887736

[Submit comment/correction]

Sequence
wsnp_Ex_c22683_31887736
Contig
3AS_3289508
Probe
wsnp_Ex_c22683_31887736
DNA Homology
3AS_3289508Best IWGSC match2700URGI_BestIWGSC_N
BLAST, e-value
03AS_3289508Best IWGSC match
DNA
atatgagatcagccaagaactcagcagggttctcatgatctgggcactgg
taccctaatgatgcaaagtatttcagaggttcttcttttgcaggccccat
Rtatacaacttctccctctgacagtagcacaatgtcatcaaatttgctat
agactgaacctctyggctggtgtatagagcatatcacagtgtgcccatct
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.