Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c28287_37424983

[Submit comment/correction]

Sequence
wsnp_Ex_c28287_37424983
Contig
1BS_3483280
Species
Triticum aestivum
Probe
wsnp_Ex_c28287_37424983
DNA
gaattcttcatatctggcggagatgggctgcctcgtggaactgttgagaa
tttggtctcgcgtgttcgtcctgtaataaatctgatcaagcaagagaccc
RTGTGCTTATTGATGATCTGCGCGAAGTTACTCAAGGGGGCAAAAGCAAA
TTCGGAAGCGACTCCAAAACCCTGCTGAGGGTCCTGTGCCACAGAAATGA
T

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.