Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c2868_5293485

[Submit comment/correction]

Sequence
wsnp_Ex_c2868_5293485
Contig
1AS_3283228
Probe
wsnp_Ex_c2868_5293485
DNA Homology
1AS_3283228Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
01AS_3283228Best IWGSC match
DNA
aggggctgtctggcacactcttatcccggaaaatgttgaggaactcggtt
tcgttttctttttctcccagatcacttgaaaatgggatgtaacttgcagg
Ratagtttgttagcggcaacactgtaaatggcggttgtaattgctgagct
gagagatagaaacgaatatatcgacagtggaacataacactaaacaaatt
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.