Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c298_580660

[Submit comment/correction]

Sequence
wsnp_Ex_c298_580660
Contig
2BL_7943289
Probe
wsnp_Ex_c298_580660
DNA Homology
2BL_7943289Best IWGSC match3500URGI_BestIWGSC_N
BLAST, e-value
02BL_7943289Best IWGSC match
DNA
gttcggtaccggcggtgtgcagcagtccagcgccgacgtagttcgtcggt
gtttccctgtttggcattgtagttctgcatagtggtaataaagttgaccc
Ragtgatcagatcagtggctcggttatggattgttgtattatagttcacc
gcagtgatgagtttgacctatttgtgactttttgctctggtctccttgtg
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.