Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c3019_5578488

[Submit comment/correction]

Sequence
wsnp_Ex_c3019_5578488
Contig
5BL_10840831
Species
Triticum aestivum
Probe
wsnp_Ex_c3019_5578488
DNA
GATGATACTGGCAGATACTGTTCGCCCATGGAAAATGAAAGAGTGTCCCA
AGCACATAAGCATGAAGAGAAACATAGAGACGGCCATGGCGATGTAGCAC
RTGGATACAATGGTAAAATCAAGTCCAGGAAGCACAGATCTGAACGGCAC
GAAAGTCTGGAGTCTGGATGTTCTGATTGGCCTTCAGAATTTGCTGATGC
A

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.