Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c3136_5798185

[Submit comment/correction]

Sequence
wsnp_Ex_c3136_5798185
Contig
5AL_2309855
Probe
wsnp_Ex_c3136_5798185
DNA Homology
5AL_2309855Best IWGSC match3640URGI_BestIWGSC_N
BLAST, e-value
05AL_2309855Best IWGSC match
DNA
gagatgaaagatgcctgtggacaatagggtcctcctcaagctgggctttr
taatcacgaagggcggtttcaaagtacttgagagatctcttagagtaggc
Rtccgctacggctttcatagcatcaacatcaggacccacatacttcaggc
tggccttagatgagattattccagcaacatcgtcagcatggttgaccatt
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.