Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c33012_41567026

[Submit comment/correction]

Sequence
wsnp_Ex_c33012_41567026
Contig
4AL_7092100
Probe
wsnp_Ex_c33012_41567026
DNA Homology
4AL_7092100Best IWGSC match3310URGI_BestIWGSC_N
BLAST, e-value
04AL_7092100Best IWGSC match
DNA
tcagggaaaaacaaaaggctcagaagccacacgggtcaacgtcgagctcg
gcgtcccccgcgctaaaasagagyggctacctgctggcggtcctggtgtc
Rctggtcgtgttttcggtcatcggacactgaactgaagtgattgccagct
agtggcactagatctgctgctatctgtgagttgttaggaaattggaaatg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.