Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c34765_43024979

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c34765_43024979
Contig
1BL_3826711
Probe
wsnp_Ex_c34765_43024979
DNA Homology
1BL_3826711Best IWGSC match2460URGI_BestIWGSC_N
BLAST, e-value
01BL_3826711Best IWGSC match
DNA
ctgacagtactctataaccagcaatccgaacgtctggatcttgttgtaga
attgatagaagaagagctgaaggagttaattttggactgtttgatgcggc
Rctgtagactaagcgcttcaggcactcttctgcttgatgatcatccagtt
tcatctggtcttcttgtcgatcaacaccacatatgcttccaaaggcatgt
a
BLAST
BLAST Search