Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c38995_46393506

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c38995_46393506
Contig
7BS_3085574
Probe
wsnp_Ex_c38995_46393506
DNA Homology
7BS_3085574Best IWGSC match3220URGI_BestIWGSC_N
BLAST, e-value
07BS_3085574Best IWGSC match
DNA
gagcgaagctcatcgacctgcttcgtagtttttggcacataagaaccaac
aactatgaggcctcccgctaaatttctttttaatccaaggtcatttgggc
Rgataggtggctttggcttgattccaattctagcactcacaaaactagca
gctgtgcgacatagaaaccgctttccttgcaattcagcctggatcattcc
a
BLAST
BLAST Search