Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c40567_47598887

[Submit comment/correction]

Sequence
wsnp_Ex_c40567_47598887
Species
Triticum aestivum
Probe
wsnp_Ex_c40567_47598887
DNA
TGATTAATGCTACCTACTATGTATAGGTATGAGTTTGAATGGTTGTGCAC
TTGTTCAGTGAGCTGCCTAGGCTGCCGGAAGGCTTGCGTAGGGGTTGTCG
RCGCAGGCCAGCTTGTCGTTGCCAGGTCGAGAAAACACAATCTGGTAAGT
TCCAAGCGTCCGTGACTTGAAACCGGCAGCACAGTATATGAAATAATACT
C
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.