Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ex_c47370_52604482

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ex_c47370_52604482
Contig
2AL_6363053
Probe
wsnp_Ex_c47370_52604482
DNA Homology
2AL_6363053Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
02AL_6363053Best IWGSC match
DNA
gatatgtacatccatcactgtgtatagcctccaggggtcttggaaatatg
cgaccgctgtctcgaggtattgatgccagcctaatttccatccgtcgctc
Magatatagcacccttgggtccaaaatcaagtctcacccaaagtgatgga
gagctacctactggtgggttatgttacttcactattgctgtgattctgtg
a
BLAST
BLAST Search